Hande, ShailajaJayabaskaran, C2015-08-012015-08-011997-03Hande Shailaja, Jayabaskaran C. Nucleotide sequence of a cucumber chloroplast proline tRNA. Journal of Biosciences. 1997 Mar; 22(2): 143-147.http://imsear.searo.who.int/handle/123456789/161104The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.enNucleotide sequencecucumber chloroplastproline tRNAArticle